Treasure hunters: I need your help.

Our dorm is having a treasure hunt. It started several days ago. The hunt takes place in teams. My team started as four, but has balloned to an affiliation of 10 persons. You can track my team "joe" at http://www.mrexonline.com/hunt/leaderboard.php?page=1

The Goal: To help Dr. Tobias Hunt find the money that Veronica Amazon stole. This is done by following clues and working through problems. The catch is that no one knows how long it will go on. We follow one clue to the next and continue on.

There have been questions that require translating from Greek and German into English plus interpreting the meaning. We have called doctors, investigated ancient greek art, and set up rooms full of computers to have multiple people reasearching.

And the hunt continues: people stay up round the clock, searching the dark woods in the rain for clues.

So I need your help on this problem. Clue 25

Question:

The coding DNA sequence of the sense-strand of DNA for a given gene is shown below. Find out the name of the normal version of this gene.

ATGAGAATAAGGAGAAGAGATGAAAAAGAGAATCAAGAATACAAGAAAGGTTTATGGACAGTTGAAGAAGACAACATCCTTATGGACTATGTTCTTAATCATGGCACTGGCCAATGGAACCGCATCGTCAGAAAAACTGGGCTAAAGAGATGTGGGAAAAGTTGTAGACTGAGATGGATGAATTATTTGAGCCCTAATGTGAACAAAGGCAATTTCACTGAACAAGAAGAAGACCTCATTATTCGTCTCCACAAGCTCCTCGGCAATAGATGGTCTTTGATAGCTAAAAGAGTACCGGGAAGAACAGATAACCAAGTCAAGAACTACTGGAACACTCATCTCAGCAAAAAACTCGTCGGAGATTACTCCTCCGCCGTCAAAACCACCGGAGAAGACGACGACTCTCCACCGTCATTGTTCATCACTGCCGCCACACCTTCTTCTTGTCATCATCAACAAGAAAATATCTACGAGAATATAGCCAAGAGCTTTAACGGCGTCGTATCAGCTTCGTACGAGGATAAACCAAAACAAGAACTGGCTCAAAAAGATGTCCTAATGGCAACTA
CTAATGATCCAAGTCACTATTATGGCAATAACGCTTTATGGGTTCATGACGACGATTTTGAGCTTAGTTCACTCGTAATGATGAATTTTGCTTCTGGTGATGTTGAGTACTGCCTTTAG