Hauling a new recliner

It is December 26^th. This means three things: a messy house, grumpy people, and bins filled with goodies just waiting to be discovered. It is unfortunately a wet day which puts a damper on the dumpster diving. I can’t let a little rain stop me. I have a new head lamp that needs to be tested.

This break has been weird. I haven’t worked at all. Generally I come home and go to work the next day. Instead I hang out with Sarah and my family. According to my studies in leisure theory I shouldn’t feel guilty.

Sarah has gone to be with her peoples. I miss her. It’s odd to talk to her on the phone instead of walking across campus to see her in person. Sometime the end of this week I will drive up to her house and hang out, then it’s off to college again.

There are a lot of new things waiting for me at college. I’m hauling in a new recliner for my room. I start a new job driving prospective students from the air ports. And I’ll have a lighter load academically (including my senior seminar).

Such is life…

Cool thing #1

Soapmaking is cool. My mother and Sarah decided to make a few batches. The following pictures document their progress. I thought it was cool...

Sarah reads up on the science of soapmaking while the vials of scents wait their fate.

Before the lye and lard can be mixed, each must be at a specific temperature. Mom and Sarah are monitoring and cooling the two before they are mixed.

Mom ponders the potential scent combination of "sticky buns" and "opium"

Batch #1 about to reach saponification (the process of lye and lard becoming soap)

cool stuff

This post is titled "cool stuff" because it reflects what I do. Yesterday I interviewed to be a Wilderness Instructor. It would be a summer intership kind of thing. I don't understand the name. Does the wilderness need instruction?

Today I'm going to make home made soap with Sarah and Mom. I would rather house clean the kitchen but making soap is somehow cooler. Tonight Jared is bringing his Sarah and the whole famdamily (Joella in spirit) is going to the Fulton to see Oliver. The trebuchet is almost fixed, so expect pictures and video of our upcoming attempt.

Not being sick is cool. I was sick last week which was finals week. I took an exam and then visited the health center. Diagnosis: 103 temp and a contagious cough. The nurse told me in a firm motherly voice to "go to bed and stay there"

Cool stuff to come...

"Christmas time is here" -Charlie Brown

A chorus of high voices are singing “Christmas time is here..” while a hollow piano accompanies the Charlie Brown tradition. Outside the snow silently steals through the dusk. Rothenbuler dorm creates an eddy from the wind. Flakes whirl up in spiraling arches. Then, caught by the wind, they set out on a straight course. I’m inside; warm, happy, and in festive spirits.

Sarah and Queena are having a night on the town. Queena’s getting a do-job on the hair and Sarah is visiting her ailing computer in Olean.

If I had completed four finals, a large Geocaching project, and six page paper detailing my philosophy on trails then I would be done for the semester. But for now I’ll enjoy being happy, and study another hour.

Below are some pictures of interest with captions.

Me (above)-contemplating how well I've balanced my
camera in my sock drawer

Sarah got a little suprise the other day.

She cried when I gave it to her and I cried when she said "yes"

Here we see Sarah applying coat number three to
the kitchen wall. Why not paint a kitchen over break?

"A lot of things in life, but only one thing I love" -rapper KJ52

Folks, here is my Christmas list published for all to see:

-Petzl tikka plus LED head lamp ($33)
-48 oz nalgene (2x$8.50)
-Warm winter coat: possibly an old navy or whatever is fashionable and reasonable ($?)
-Games that 2 or more persons can play (game surplus.com)
-Long sleeve shirts or sweaters
-a honeymoon with Sarah in the white mountians of New Hampshire ($850?)



Most of you who buy for me know each other, so it might be good to e-mail each other so I don't get 4 sweaters, 2 honeymoons, and no head lamp.

a disjointed rant

The efficiency of technology has juiced up our society to our point of hypertension, stress, and increasing expectations. Our friend has become our enemy. These devices designed to save us are smothering us. Our communication has become impersonal: email instead of phone calls, ipods instead of social interaction, blogs instead of mass emails, and facebook instead of blogs.

I have a shoe box with dozens of pages of letters. It is a one sided history of my growing love for Sarah. I don’t regret the extra hours it took to write instead of email. Nor do we wish we had cash for the used stamps. We communicated in real ways. It would have been a betrayal of our values to thoughtlessly fling our experiences through the web. I would have robbed myself of those moments in Kenya where I sat writing as the creek guggled by and the goats grazed.

So, as you might have noticed, I post about things that don’t really matter. I do this with the assumption that anyone who cares about me will take the time to actually ask me “Kevin, how are you?” I have more than a hundred friends on face book. But I would trade them all for a real relationship.

This has been kind of a disjointed rant, but I think you get the idea. If anything important is going on in my life, you won’t see it here. Ask me, not technology for details.

my mother thinks I’m a success

I am an adult. I may not be a mature adult, but I am, nonetheless an adult. I’ve waited all my life to be one. All of those things I wasn’t allowed to do, I can now do. My childhood statements of “when I’m grown up I’ going too…” are starting to happen. I’ve abolished bed times, let myself eat pizza for breakfast, and never take out the trash. And my mother thinks I’m a success. (What were her hopes for me anyway?) Irresponsibility is wonderful some days.

Responsibility is harder when I’ve been irresponsible. The New York State Department of Conservation officers I met Friday night thought I was irresponsible. Maybe that’s why they made me stand in a line with my friends and keep my hands where they could see them. Seriously, did they need four law enforcement vehicles to apprehend me? A guy can’t even have a good time without someone breathing down his neck about the wrong permit.

Life is dividing

I spent about 12 hrs on a take home test. Most everyone else in the class spend much less. I got it back: 81% was never so dissapointing. I've been going through life juggling a dozen different balls, and they are starting to hit the ground. I've always tried to do well at what I do, but I'm coming to realize that some things are less important than others. Those others have begun to hit the ground. Life is dividing into "importants" and "less importants" and somthing has to give. I could hold a 3.5 GPA, but the cost is to great. It kills me to let it go.

Treasure hunters: I need your help.

Our dorm is having a treasure hunt. It started several days ago. The hunt takes place in teams. My team started as four, but has balloned to an affiliation of 10 persons. You can track my team "joe" at http://www.mrexonline.com/hunt/leaderboard.php?page=1

The Goal: To help Dr. Tobias Hunt find the money that Veronica Amazon stole. This is done by following clues and working through problems. The catch is that no one knows how long it will go on. We follow one clue to the next and continue on.

There have been questions that require translating from Greek and German into English plus interpreting the meaning. We have called doctors, investigated ancient greek art, and set up rooms full of computers to have multiple people reasearching.

And the hunt continues: people stay up round the clock, searching the dark woods in the rain for clues.

So I need your help on this problem. Clue 25

Question:

The coding DNA sequence of the sense-strand of DNA for a given gene is shown below. Find out the name of the normal version of this gene.

ATGAGAATAAGGAGAAGAGATGAAAAAGAGAATCAAGAATACAAGAAAGGTTTATGGACAGTTGAAGAAGACAACATCCTTATGGACTATGTTCTTAATCATGGCACTGGCCAATGGAACCGCATCGTCAGAAAAACTGGGCTAAAGAGATGTGGGAAAAGTTGTAGACTGAGATGGATGAATTATTTGAGCCCTAATGTGAACAAAGGCAATTTCACTGAACAAGAAGAAGACCTCATTATTCGTCTCCACAAGCTCCTCGGCAATAGATGGTCTTTGATAGCTAAAAGAGTACCGGGAAGAACAGATAACCAAGTCAAGAACTACTGGAACACTCATCTCAGCAAAAAACTCGTCGGAGATTACTCCTCCGCCGTCAAAACCACCGGAGAAGACGACGACTCTCCACCGTCATTGTTCATCACTGCCGCCACACCTTCTTCTTGTCATCATCAACAAGAAAATATCTACGAGAATATAGCCAAGAGCTTTAACGGCGTCGTATCAGCTTCGTACGAGGATAAACCAAAACAAGAACTGGCTCAAAAAGATGTCCTAATGGCAACTA
CTAATGATCCAAGTCACTATTATGGCAATAACGCTTTATGGGTTCATGACGACGATTTTGAGCTTAGTTCACTCGTAATGATGAATTTTGCTTCTGGTGATGTTGAGTACTGCCTTTAG

Toss some stuff

I went home this weekend. Asher has been constructing the Trebuchet we designed this summer. He did a nice job on it, but he needed our help to install a larger counter weight so that it would toss some stuff. Since I went to college to tie knots I was responsible for the attachment part.

I am a recreation professional, not an engineer. I tied the knots without calculating the movement of the 18' throwing arm. The results were unfortunate. You can watch them below.

http://www.youtube.com/watch?v=VgILYY3P7hM

Permafrost

Kitchen

A Bed room (very messy version)

Living room

The Canadian cold has snuck down across the great lakes and smothered campus. It was a wet silent invasion; the kind that muffles every sound and enhances every smell. Freshness, wood smoke, and wet leaves; the scents that greet my nose as I carry my books to the coffee shop. I watched the invasion from the wires of the ropes course. It swarmed through the hemlocks and before I realized it the trees changed from fall to winter. It happens. Tonight our dorm will celebrate with a welcoming ritual.

A silence will make the word stronger

I should apologize to all of my loyal fans who have come seeking wisdom and enlightenment only to be greeted by old knowledge and fading pictures. I am, however, not apologizing. This is my blog and I'll do what I want. So instead I've posted some new and exciting pictures.

The last two weeks have been some of the most academicly demanding. I've been doing 12-14hr days during the week. But during the weekends I can have a bit more fun. Most of the pictures here are from weekends.


I planned a canoe trip for the guys on my floor, and my sister floor. This is taken from my canoe as we drifted along.


Sarah and I went to Lechworth State Park for a date. Rather than pay the parking fee, we rode our bikes into the park and used the money for grillable things. This picture is one of the waterfalls that makes the park popular
This is home coming weekend. My home was to distant to go to, so Sarah, Queena, and I went to Sarah's home to celebrate homecoming. Her parents needed some childcare so it worked out just fine. We cooked a banquet and had everyone dress up. Photo credit: QueenaHDC had me lead another backpacking trip. Above is the scenery, and below are the people (one of two all girls teams). I had never taken two teams together, much less all girls teams. But with Danny's assistance we had a reasonably good time. At least I didn't have to stop testosterone charged boys from burning down the forest. Notable people are Kara (left) and Ivanna "you go girl!" (right). Both loved the city and hated the wilderness, but had incredibly positive attitudes about the whole lot. They taught me a lot, including the phrase "I'll pop you in the boca."

A small swamp around the center wicket

My family came to see me this weekend. They brought lots of yummy food and various odds and end which a person finds themselves in need of (Steel toed work boots, an ax, and a cowboy hat). They also packed the croquet set. On Saturday we all visited the quaint little town of Angelica, NY to try out the clay croquet court in the park circle. Even with a small swamp around the center wicket we successfully played several games and then took a walking tour of the town. The main industry in Angelica is old nic nacs and so we were entertained for a very long time visiting the local shops. Other notable activities include swimming in the pool and ping pong.

...and part of a morning

A project that I thought wasn't a big deal turned into a 10 page paper. I can't believe I did it in one night (and part of a morning). I hate procrastination.

We walk around in the woods and pick flowers

So now I'm at College. That statement contains a great deal that cries out "write about me". The chorus of little voices is made up of unique faces, each face with a personality, and a story.

Sarah is in the chorus. In half a week she decided to enroll as a student. Half a week would be considered "impulsive" by most Mast standards, but I don't mind. It's nice to have her around. It's also very weird. On the 17^th of this month we will have been dating 21 months. Nowhere in those months could you have found us in the same state for more than two weeks, so it's taken some adjustment to understand how to live separate yet intersecting lives.

Queena is in the chorus. She shares a room, and a reasonable amount of time with Sarah. There aren't really words to describe her actions on campus other than that they are very much what you would expect when you leave an engaged Queena at a Christian Liberal arts College.

Mr. RA is in the chorus. He does what a good RA should do: He facilitates a Christian academic living environment. He tries to be a role model for the guys on his floor while planning spiritual and social activities. It takes a lot of time, but he likes it. Right now he is working on a canoe trip with his sister floor.

Then there are classes. They can sing loudly. I have a wide variety of Rec. classes with one Bio. For Biology we identify things, and learn about identifying things. Several hours a week we walk around in the woods and pick flowers trying to identify them. It's cool. But not as cool as trail development. Because in TD we build things in the woods (what could be more fun?). I didn't realize that the concepts behind trails were so complex. It's a four credit class, and that means almost six hrs a week of independent lab work (designing, mapping, and building). I get to use my GPS a lot for that one.

So that's my life in a nutshell. I'm going to try to write more regularly now that my life has recovered from a month of transition. A month ago I was leaving landscaping. Feel free to leave questions as comments.

1962

If you look closely in life, one can find the oddest things. And graveyards are no exception. Look closely at the pictures of this gravestone (front and back). Isn't it odd? You can't see it well, but the front has two doves holding a banner which reads "1962"-the kind that usually indicates marriage. I'm so confused by it.

Sarah and I often visit graveyards. Our first walk as a couple was to a graveyard, and we have been paying our respects ever since. Some people think it is a kind of morbid obsession, and it's ok for them to think that. If they view graveyards as a field of rotting flesh, then maybe it is best for them to avoid it. But we view cemeteries as well manicured parks filled with uniquely personalized historical markers. Spend a half of an hour walking the rows of stones and your life seems to shrink in importance. We are a moment and in 200 hundred years all that will be left is a broken stone that someone mows around, and hope that we have passed on to others. As I look at the stones I always wish I knew the stories of the people who lie below: the tragic deaths, the two wives, or that bronze military plaque. So many stories lie buried and silenced.

A Good girl became a Charles

Life changes in an instant. When the weather stops being humid, I go back to Houghton, and Sarah comes home all at the same time, it feels like I’ve completely switched cultures.

There are several bloggable events that have happened since I last wrote. A Good girl became a Charles and Asher and I did the parking. We thought that since it was cooler we would direct in style. Just about every seat at Bosslers was filled for the ceremony, but we found a way to have extra parking.

On Friday I collected Sarah while I waited in a gas line (that’s a romantic meeting spot). Together we put several hundred miles on my car proving that it is a fine machine. I was very pleased with it’s first test. It got 38-40 mpg w/ the AC on and several hundred pounds of luggage while driving the mountains of MD. Somehow life seems to never slow down when she is around. We partied at her family reunion with the very in love Queena and Ethan. Some were sure that we got lost. But I will say it again: “we did not get lost!” Sarah is amazing with a map, but only when I am driving.

And time rolls on….

I'm not actually Kevin Yoder

So if you came here looking for someone besides Kevin Yoder, you found him, he is just using a different name to hide his identity.

More dumpster diving success last night. Two unassembled china cabinets climbed out of the bin and into my little Saturn. One was damaged and one was missing some pieces. We combined them to make a good piece and set both for sale along the road. When I got home this evening both cabinets were gone and I had more money for the “date fund”. I wanted to post a picture of them, but they sold too fast.

I'm sitting on a mini-fridge

So I got a car. It could be best described as “a grandpa car”. Gold isn’t exactly the hottest color on the market and 1995 was a while ago. But 43K isn’t much, and a standard transmission will be nice. The dent resistant sides will soon undergo late night testing in a walmart parking lot. Plastic seems to be the key in making this little guy light and efficient. I wonder if he is made out of recycled milk jugs?

I preached this Sunday. It was rough; I lost my train of thought a lot. But it was well received. I’m glad that it’s over; the preparation seemed to take a lot of time and stress. This week is the softball playoffs. We have a good shot at winning, but nothing is sure, we have a history of loosing games we shouldn’t have.

I would say more, but I’m sitting on a mini-fridge instead of my chair (sent it to NY). And there is a geo-cache waiting to be found.

They diagnosed my little guy

Mr. MazdaI spent all day at the beach: 15 min. wading, the rest in the sand.

Sarah and I talked a few weeks ago. She wanted me to come out and pick her up, which made me wonder: “how far can my car go?” To be safe I took it to a transmission shop. They diagnosed my little guy with a failing transmission, and I estimated he had 2-4 months to live. Treatment is expensive so I decided to let him go. I met a guy who said that he can give him a good home. And so Mr. Mazda is moving on.

So now I’m shopping and hope to close a deal on a new ride. The downside is that work has been really slow. Did you see the sand castle? I actually took a day off, went to the beach, and shoveled for hours just for fun. Any landscaper who does that must not be doing much at work. But hey, it is not so bad. I have less than a month before I get to collect Sarah. I don’t think I ever looked forward to driving down the turnpike so much!

It takes ten hits to get a dot that big

Do you ever feel like you are being watched? I do, especially when I’m trying not to be seen: like when I’m dumpster diving or peeing behind a bush at work. The truth is everything we do is monitored. Between your cell phone, cameras at intersections, and monitored emails the government knows exactly where you are. (Actually I have no idea if they know where you are, it just made a good intro)

If you noticed there is a little map on the side bar of my blog. When you look at my blog a program records the general location of where your request came from. A good look at the map and you know where my loved ones live. The bigger the dot, the more hits from that area. The splattering of small dots are either people who stumbled across my blog once or who have looked at it less than ten times since June 12^th (the day the program started monitoring).

The dot with the green arrow confuses me. It takes ten hits to get a dot that big. I don’t remember having any friends in south western Canada. Ten hits in a month is a lot: more than I get from India. So I am interested to know the names behind the dots. So if you read my blog, leave a comment with your name and the city you view from. (Especially my Canadian friend).

The Annual wild goat round up

Life on a ranch in always exciting. Ok, so I don't live on a ranch, but it is exciting. Last night we had the annual wild goat round up. Dewormer was on the menu for the whole herd. Here are some pictures.
I had the worst time catching this one. I tried the neck tackle a few times but eventually got her when she slipped in some manure.

If you have an upset stomach what do you take? The same works on goats, though they don't drink it down like you did when you where young.
Geocaching can get a little weird at times. I could have sworn the cache was hidden there, but it wasn't.

We found a pool like this one when we were dumpster diving. It was brand new so decided to sell it along the road. Split $60 two ways and I still have a nice wad to add to the "date fund".

who buys your sugar?

So the other night I was at Jeremy’s new house and made some coffee. I asked where the sugar was. “We don’t have any, who buys your sugar?”

“My mom”

“That’s why we don’t have any sugar”

Then I was given this cool tent. I think it is disproportionately tall, but I welcome that after sleeping in the “Squeeze Inn” for several years.

I also got some poision Ivy on my hands. If you have ever had it, you will recognize those little bumps.

I set off some illegal bottle rockets to celebrate our freedom

A car I saw geo-caching

I’ve been doing some organizing. Asher snagged a dresser and chest from along the road and I organized my camping stuff in them. Then I went through a pile of candles that came from a dumpster months ago: some will become fire starters and I might find a normal use for the rest.

Asher and I went to the fire works last night. Joella had my camera so I didn’t get any pictures. I would have had some good ones: we found a killer spot to watch the sparks that went boom. We parked next to a construction site, walked down a back road, ducked into a hedge row, waded through briars and poison to our perfect overlook of Marietta.

Just this evening Asher and I set off some illegal bottle rockets to celebrate our freedom. Here are the pictures.

1 rocket

125 rockets

The thing still buzzes right along

I thought this was a cool picture. I saw the guy mowing and thought it would be worth displaying on my blog. With all the rain we have had, I'm sure he will be giving lots of mower rides.

The rain we got this week was a lot like the rain we got in Kenya. It was a steady, almost downpour that went on for a while. The only difference is that in Kenya the mud becomes really slippery (even more so than snow). My good friend RAY discovered this while descending a bank in a skirt.

My car broke down. Well, actually it has been continuing a problem started back two years ago. Its the alternator and it's related accessories not working correctly. A motor mount is also broken and could be contributing to some shifting difficulties. But I'm not worried, if it surrenders to all of these ailments and gives up the ghost I have two bikes which I could ride.

It's been years since I rode bike. But last night I got out my road bike and took for a ride. The thing still buzzes right along, although the digital speedometer doesn't work perfectly. If I would ride that to work I would be skinny in no time.

And now a program note: After reviewing the purpose of this blog "to say what I want to..." I decided that having you find 149 in each picture wouldn't be in keeping with my purpose. Right now I don't feel like hiding 149, so to hide it would be doing somthing that I don't want to do. And that is a violation of my principle.

Liberate some dumpster finds

This next week is gonna rock. My three sisters are at camp, Asher has the grill set up on the deck, and my parents are on a raft in the Grand Canyon (the real one, not the PA version). Did I mention that my boss is in Montana? Can life get any better? I submit that it cannot. Ok, so maybe Sarah could make a surprise visit and we could go to the Creation Festival together, but I’m thinking that won’t be happening. But grilling every night on the deck is going to happen. Asher has some killer grilling skills and we are going to liberate some dumpster finds from the freezer.

Speaking of dumpsters: we made a haul last night. The last thing I expected to bring home on a hot humid night was a garbage bag full of cheese. The meat, cheese, and milk season has been over for a while but last night we got to the dumpster and the cheese was still cold: fresh from the store. We hauled out three boxes of varying types along with some Lebanon bologna.

My days geocaching are going better. With some online mapping I’ve been better able to plan routes and trips. If any of you ever want to go, it’s always more fun with more people. I’m thinking about doing some hides around E-town. The borough only has four and Mount Gretna has more than twenty. E-town shouldn’t be a second rate caching town to Mount Gretna.

Asher and I had some fun last night. We drove through town trying to build a global community. I saw a guy on his porch so I greeted him with a wave and “hey Steve!” Apparently he was building a global community as well because he responded. There was a couple across from the music store and Asher gave them a thumbs up.

As part of a new feature on my blog each entry will have the number 149 hidden somewhere in a picture. Be the first to describe it’s location in a comment and I’ll say something cool about you. You may have to zoom in on some of the pictures to look close enough.