I just need a decent place to live

Western New York is different than Lancaster. The culture, language and expectations are vastly different. Shopping for a place to live has put me deeper into the local scene than I’ve ever been. It is rich. Everything is laid back and non-professional. I talked to the realtor today and felt completely at home in my jeans and sweat shirt. He gave me the three names of people who rent in the area. I’ve checked the classifieds. There must be something about the word “decent” it keeps showing up in the adds:

“Decent 2^nd floor 2 bedroom apartment. Includes1/2 garage & big yard...”

"Decent houses/Owner finacing/Low payments..."

We had a good time most of the time

Yes, there is music playing. I figured out how to do it and I'm not sure if I like it or not. Leave your vote. This song always runs through my head when I hike the rolling hills of the Appalachian Trail.

I'm back from backpacking. It was my job to safely escort The Gambia team over 30 miles of snowy AT. No-one died, and the injuries were minor. I am proud to report that I am not sore and have not experienced caffeine withdraw. They can be an ugly combination. On the first day we walked on the snow, on the second day we began to break through about every fifth step which made walking exhausting. The next day it got warm (my GPS said 68 degrees) and the snow became four inches of mush that found every hole in my gore-tex boots. All that melted slop froze, and this morning at 4:45am the mountain was an icy slope. It's a good thing I hike with ski poles.

The Gambia team decided to hike as early as possible. We ate, packed, and hiked in the dark. When the sun came up I was standing on the summit of Center Point Knob waiting for it. (The Gambia team was somewhere below looking for their directions). We had a good time most of the time and I learned once again that dried fruit causes very, very unpleasant things to happen.

"the moral of the story is...

I’ve been thinking about what Donald Miller (wrote blue like jazz) said when he visited the other week. He said that God gives up the Bible in narrative form and we turn it into propositions, statements of faith, and bulleted sermons. He says that we as people connect with stories better than we connect with statements, that’s why God gave us the Bible filled with narrative. Have you ever gone to a movie and after it was all over asked your friends “guys, what can we learn from this movie?” I don’t. When Jesus told stories (parables) he didn’t conclude by saying “the moral of the story is…” He left people wondering what it meant.

Donald Millers said that we all want to be part of a good story. We want our lives to count for something. The problem is that all good stories go like this. Protagonist wants something. Protagonist faces conflict. Protagonist preservers through and a conclusion is reached. Lord of the Rings would have been a flop if Froto had given up and pawned the ring off on some unknowing soul headed to mount doom.

I’m wondering about my own life. I don’t want to live a lame, or boring life. I am also fearful of the consequences that come from living a life that involves me in a greater plot.

And this is the end of my very disjointed thoughts.

Can I copyright my actions?

Sometimes I don’t know what to do. Can I copyright my actions? I think I’ll sue my brother for copying me.

First I go to Rosedale, then he comes. I wait until the last day of classes and ask out Sarah. Then he waits and asks another Sarah. Then I give my Sarah a diamond ring and ask her to spend the rest of her life with me. Would you believe that he asked her the same thing using his own diamond? Unbelievable!

Welcome to the family Sarah.

Maybe I'll have a cup of Good Earth Tea to make me feel better

I snuck a few little buggers...

For years I was allergic to bananas. More than half of that peeled sweet goodness and I would be begging to vomit my sick stomach away. In Africa I snuck a few little buggers and nothing happened. Could it have been the chemicals in western food?

This week at lunch I’ve been snaging a few bites here and there to see what happens. And nothing did. Today I put down two whole bananas over the lunch hour, with no ill effects. I guess God wants me to start eating bananas again. Wooo Hoooo!

I should be an expert by next Tuesday

Sunday Night at 7:29pm

I don’t know why I volunteered to give my senior seminar presentation so soon. I have 216 hours until I take the lectern. At least it will be over before the semester really starts. If only there were four exams less between now and then. If anyone has questions about global warming I should be an expert by next Tuesday.

Sarah and I visited her family for a birthday celebration. Since they had more snow than college does we helped the younger four build a snow fort. We had to hurry back, the International banquet was last night. We went in Indian attire.

The snow continues to fall. This afternoon as I was learning how climate change will cause the Midwest to become a dessert I looked out my window to see some very intense snow fall. It’s still going strong. When will it stop? Maybe the global warming experts know.

If I focused all of my mental ability...

There is a swing dancing movement in Rochester. Sarah and I have wanted to go for a while. Last night it happened. A student ID and $7 will buy a 45 min. group lesson and 3 hrs of live music and dancing.

We arrived late for the lesson. I learned how to move my feet, hold my arms, and spin my girl and then the lights dimmed and the band began. We retreated to the far corner of the dance floor. I tried to concentrate on my very basic foot work. If I focused all of my mental ability I could do something that resembled an east coast step and clumsily spin Sarah. It was hard to focus. The dance floor was filled with spinning, pulsating and vicarious characters. Most could have been my grandparents. The band’s lead singer looked like the driver from “Driving Miss Daisy”. Their jazz flowed off of the stage and seemed to make the crowd come alive. By the end of the night we were swinging with the best of the first timers.

And then began the trip home. Rochester is a navigational night mare. We combined my nose, the GPS, and Sarah’s map reading skills to get from the rainy streets and into the country side filled with sleepy towns. In the sleepy town of Geneseo we met a local representative at the stroke of midnight. He asked a lot of questions: “where are you going? Where are you coming from?” He was kind and gave me a keepsake to remember our visit. He said that if I didn’t want the keepsake I could plead not-guilty and appear at the Geneseo Village Court on February 6^th. I have been driving for 7 years without a keepsake, so I decided to keep it. So much for a year of Jubilee!

More cool stuff...

My recliner didn’t fit. There was no possible way to fit its mass into my car. No amount of twisting and turning could coax it in. I’m in NY and it is someone else’s treasure.

I hung around home a bit longer to chill with my family from MO. With some more work on the trebuchet we managed to fling a piece of fire wood almost 100 feet. Unfortunately it took the launching sling with it. A new sling and a lot of adjustment latter we still haven’t made progress.

Then I headed to NY to chill with Sarah’s peoples. Oh what a time! Their version of New Years celebration includes massive amounts of junk foods and old friends for 3 days. Good times were had by all with the exception of Dean who required self administered stitches after opening a frozen bagel (and his hand). Esther acquired a puncture wound to the hand after someone booby trapped the trash can.

Ben came by for a few days. We did a Geocaching run in Alleghany State Park. In the 8^th find of the day we found a lottery ticket. That’s a Mennonite dilemma. I solved the dilemma, scratched the ticket and won $25. I never dreamed I would win the lottery J

Wedding plans are underway. On Sunday August 12 I will wed Sarah with Pastor Jones presiding. Location: Salamanca, NY. Reception: pending. Wedding dress: fitted and delivered. Engagement pictures: taken, ordered and on their way.

And it snowed today…

Hauling a new recliner

It is December 26^th. This means three things: a messy house, grumpy people, and bins filled with goodies just waiting to be discovered. It is unfortunately a wet day which puts a damper on the dumpster diving. I can’t let a little rain stop me. I have a new head lamp that needs to be tested.

This break has been weird. I haven’t worked at all. Generally I come home and go to work the next day. Instead I hang out with Sarah and my family. According to my studies in leisure theory I shouldn’t feel guilty.

Sarah has gone to be with her peoples. I miss her. It’s odd to talk to her on the phone instead of walking across campus to see her in person. Sometime the end of this week I will drive up to her house and hang out, then it’s off to college again.

There are a lot of new things waiting for me at college. I’m hauling in a new recliner for my room. I start a new job driving prospective students from the air ports. And I’ll have a lighter load academically (including my senior seminar).

Such is life…

Cool thing #1

Soapmaking is cool. My mother and Sarah decided to make a few batches. The following pictures document their progress. I thought it was cool...

Sarah reads up on the science of soapmaking while the vials of scents wait their fate.

Before the lye and lard can be mixed, each must be at a specific temperature. Mom and Sarah are monitoring and cooling the two before they are mixed.

Mom ponders the potential scent combination of "sticky buns" and "opium"

Batch #1 about to reach saponification (the process of lye and lard becoming soap)

cool stuff

This post is titled "cool stuff" because it reflects what I do. Yesterday I interviewed to be a Wilderness Instructor. It would be a summer intership kind of thing. I don't understand the name. Does the wilderness need instruction?

Today I'm going to make home made soap with Sarah and Mom. I would rather house clean the kitchen but making soap is somehow cooler. Tonight Jared is bringing his Sarah and the whole famdamily (Joella in spirit) is going to the Fulton to see Oliver. The trebuchet is almost fixed, so expect pictures and video of our upcoming attempt.

Not being sick is cool. I was sick last week which was finals week. I took an exam and then visited the health center. Diagnosis: 103 temp and a contagious cough. The nurse told me in a firm motherly voice to "go to bed and stay there"

Cool stuff to come...

"Christmas time is here" -Charlie Brown

A chorus of high voices are singing “Christmas time is here..” while a hollow piano accompanies the Charlie Brown tradition. Outside the snow silently steals through the dusk. Rothenbuler dorm creates an eddy from the wind. Flakes whirl up in spiraling arches. Then, caught by the wind, they set out on a straight course. I’m inside; warm, happy, and in festive spirits.

Sarah and Queena are having a night on the town. Queena’s getting a do-job on the hair and Sarah is visiting her ailing computer in Olean.

If I had completed four finals, a large Geocaching project, and six page paper detailing my philosophy on trails then I would be done for the semester. But for now I’ll enjoy being happy, and study another hour.

Below are some pictures of interest with captions.

Me (above)-contemplating how well I've balanced my
camera in my sock drawer

Sarah got a little suprise the other day.

She cried when I gave it to her and I cried when she said "yes"

Here we see Sarah applying coat number three to
the kitchen wall. Why not paint a kitchen over break?

"A lot of things in life, but only one thing I love" -rapper KJ52

Folks, here is my Christmas list published for all to see:

-Petzl tikka plus LED head lamp ($33)
-48 oz nalgene (2x$8.50)
-Warm winter coat: possibly an old navy or whatever is fashionable and reasonable ($?)
-Games that 2 or more persons can play (game surplus.com)
-Long sleeve shirts or sweaters
-a honeymoon with Sarah in the white mountians of New Hampshire ($850?)



Most of you who buy for me know each other, so it might be good to e-mail each other so I don't get 4 sweaters, 2 honeymoons, and no head lamp.

a disjointed rant

The efficiency of technology has juiced up our society to our point of hypertension, stress, and increasing expectations. Our friend has become our enemy. These devices designed to save us are smothering us. Our communication has become impersonal: email instead of phone calls, ipods instead of social interaction, blogs instead of mass emails, and facebook instead of blogs.

I have a shoe box with dozens of pages of letters. It is a one sided history of my growing love for Sarah. I don’t regret the extra hours it took to write instead of email. Nor do we wish we had cash for the used stamps. We communicated in real ways. It would have been a betrayal of our values to thoughtlessly fling our experiences through the web. I would have robbed myself of those moments in Kenya where I sat writing as the creek guggled by and the goats grazed.

So, as you might have noticed, I post about things that don’t really matter. I do this with the assumption that anyone who cares about me will take the time to actually ask me “Kevin, how are you?” I have more than a hundred friends on face book. But I would trade them all for a real relationship.

This has been kind of a disjointed rant, but I think you get the idea. If anything important is going on in my life, you won’t see it here. Ask me, not technology for details.

my mother thinks I’m a success

I am an adult. I may not be a mature adult, but I am, nonetheless an adult. I’ve waited all my life to be one. All of those things I wasn’t allowed to do, I can now do. My childhood statements of “when I’m grown up I’ going too…” are starting to happen. I’ve abolished bed times, let myself eat pizza for breakfast, and never take out the trash. And my mother thinks I’m a success. (What were her hopes for me anyway?) Irresponsibility is wonderful some days.

Responsibility is harder when I’ve been irresponsible. The New York State Department of Conservation officers I met Friday night thought I was irresponsible. Maybe that’s why they made me stand in a line with my friends and keep my hands where they could see them. Seriously, did they need four law enforcement vehicles to apprehend me? A guy can’t even have a good time without someone breathing down his neck about the wrong permit.

Life is dividing

I spent about 12 hrs on a take home test. Most everyone else in the class spend much less. I got it back: 81% was never so dissapointing. I've been going through life juggling a dozen different balls, and they are starting to hit the ground. I've always tried to do well at what I do, but I'm coming to realize that some things are less important than others. Those others have begun to hit the ground. Life is dividing into "importants" and "less importants" and somthing has to give. I could hold a 3.5 GPA, but the cost is to great. It kills me to let it go.

Treasure hunters: I need your help.

Our dorm is having a treasure hunt. It started several days ago. The hunt takes place in teams. My team started as four, but has balloned to an affiliation of 10 persons. You can track my team "joe" at http://www.mrexonline.com/hunt/leaderboard.php?page=1

The Goal: To help Dr. Tobias Hunt find the money that Veronica Amazon stole. This is done by following clues and working through problems. The catch is that no one knows how long it will go on. We follow one clue to the next and continue on.

There have been questions that require translating from Greek and German into English plus interpreting the meaning. We have called doctors, investigated ancient greek art, and set up rooms full of computers to have multiple people reasearching.

And the hunt continues: people stay up round the clock, searching the dark woods in the rain for clues.

So I need your help on this problem. Clue 25

Question:

The coding DNA sequence of the sense-strand of DNA for a given gene is shown below. Find out the name of the normal version of this gene.

ATGAGAATAAGGAGAAGAGATGAAAAAGAGAATCAAGAATACAAGAAAGGTTTATGGACAGTTGAAGAAGACAACATCCTTATGGACTATGTTCTTAATCATGGCACTGGCCAATGGAACCGCATCGTCAGAAAAACTGGGCTAAAGAGATGTGGGAAAAGTTGTAGACTGAGATGGATGAATTATTTGAGCCCTAATGTGAACAAAGGCAATTTCACTGAACAAGAAGAAGACCTCATTATTCGTCTCCACAAGCTCCTCGGCAATAGATGGTCTTTGATAGCTAAAAGAGTACCGGGAAGAACAGATAACCAAGTCAAGAACTACTGGAACACTCATCTCAGCAAAAAACTCGTCGGAGATTACTCCTCCGCCGTCAAAACCACCGGAGAAGACGACGACTCTCCACCGTCATTGTTCATCACTGCCGCCACACCTTCTTCTTGTCATCATCAACAAGAAAATATCTACGAGAATATAGCCAAGAGCTTTAACGGCGTCGTATCAGCTTCGTACGAGGATAAACCAAAACAAGAACTGGCTCAAAAAGATGTCCTAATGGCAACTA
CTAATGATCCAAGTCACTATTATGGCAATAACGCTTTATGGGTTCATGACGACGATTTTGAGCTTAGTTCACTCGTAATGATGAATTTTGCTTCTGGTGATGTTGAGTACTGCCTTTAG

Toss some stuff

I went home this weekend. Asher has been constructing the Trebuchet we designed this summer. He did a nice job on it, but he needed our help to install a larger counter weight so that it would toss some stuff. Since I went to college to tie knots I was responsible for the attachment part.

I am a recreation professional, not an engineer. I tied the knots without calculating the movement of the 18' throwing arm. The results were unfortunate. You can watch them below.

http://www.youtube.com/watch?v=VgILYY3P7hM

Permafrost

Kitchen

A Bed room (very messy version)

Living room

The Canadian cold has snuck down across the great lakes and smothered campus. It was a wet silent invasion; the kind that muffles every sound and enhances every smell. Freshness, wood smoke, and wet leaves; the scents that greet my nose as I carry my books to the coffee shop. I watched the invasion from the wires of the ropes course. It swarmed through the hemlocks and before I realized it the trees changed from fall to winter. It happens. Tonight our dorm will celebrate with a welcoming ritual.

A silence will make the word stronger

I should apologize to all of my loyal fans who have come seeking wisdom and enlightenment only to be greeted by old knowledge and fading pictures. I am, however, not apologizing. This is my blog and I'll do what I want. So instead I've posted some new and exciting pictures.

The last two weeks have been some of the most academicly demanding. I've been doing 12-14hr days during the week. But during the weekends I can have a bit more fun. Most of the pictures here are from weekends.


I planned a canoe trip for the guys on my floor, and my sister floor. This is taken from my canoe as we drifted along.


Sarah and I went to Lechworth State Park for a date. Rather than pay the parking fee, we rode our bikes into the park and used the money for grillable things. This picture is one of the waterfalls that makes the park popular
This is home coming weekend. My home was to distant to go to, so Sarah, Queena, and I went to Sarah's home to celebrate homecoming. Her parents needed some childcare so it worked out just fine. We cooked a banquet and had everyone dress up. Photo credit: QueenaHDC had me lead another backpacking trip. Above is the scenery, and below are the people (one of two all girls teams). I had never taken two teams together, much less all girls teams. But with Danny's assistance we had a reasonably good time. At least I didn't have to stop testosterone charged boys from burning down the forest. Notable people are Kara (left) and Ivanna "you go girl!" (right). Both loved the city and hated the wilderness, but had incredibly positive attitudes about the whole lot. They taught me a lot, including the phrase "I'll pop you in the boca."